Skip to main content

Table 1 Primers for VDR polymorphisms

From: 25-hydroxyvitamin D deficiency, exacerbation frequency and human rhinovirus exacerbations in chronic obstructive pulmonary disease

PCR Forward primer Reverse primer
VDR AGCTGGCCCTGGCACTGACTCTGCTCT ATGGAAACACCTTGCTTCTTCTCCCTC
FokI
VDR GGGACGATGAGGGATGGACAGAGC GGAAAGGGGTTAGGTTGGACAGGA
TaqI
VDR AACTTGCATGAGGAGGAGCATGTC GGAGAGGAGCCTCTGTCCCATTTG
BsmI