Skip to main content

Table 2 Sequences for real-time PCR primers and GenBank accession numbers

From: Short-term glutamine supplementation decreases lung inflammation and the receptor for advanced glycation end-products expression in direct acute lung injury in mice

Gene GenBank accession Amplicon size (bp)      Sequence
COX-2 NM_011198 147 F: 5′-AAGCCGAGCACCTTTGGAG
R: 5′-ATTGATGGTGGCTGTTTTGGTAG
iNOS NM_010927 63 F: 5′-GGGCAGCCTGTGAGACCTT
R: 5′-TGAAGCGTTTCGGGATCTG
IL-1β NM_008361 99 F: 5′- GATCCCAAGCAATACCCAAA
R: 5′- GGGGAACTCTGCAGACTCAA
IL-6 NM_031168 140 F: 5′- TCCAGTTGCCTTCTTGGGAC
R: 5′- GTGTAATTAAGCCTCCGACTTG
Nox-1 NM_172203 215 F: 5′-CTGACAAGTACTATTACACGAGAG
R: 5′- CATATATGCCACCAGCTTATGGAAG
RAGE NM_007425 91 F: ACTACCGAGTCCGAGTCTACC
R: CCCACCTTATTAGGGACACTGG
GAPDH NM_008084 123 F: 5′-AGGTCGGTGTGAACGGATTTG
R: 5′-TGTAGACCATGTAGTTGAGGTCA
  1. F, Forward; R, Reverse; COX-2, cyclooxygenase-2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; iNOS, inducible nitric oxide synthase; IL-1β, interleukin 1β; IL-6, interleukin 6; Nox-1, NADPH oxidase; RAGE, advanced glycation end-products.