Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers, PCR conditions and restriction enzymes used for genotyping

From: Surfactant protein Bpolymorphisms are associated with severe respiratory syncytial virus infection, but not with asthma

Polymorphism Primer PCR condition Restriction enzyme
rs 2077079 AGCCACAAGTCCAGGAACAT ATGCCTAGCACAAAGCAGTG 65°-55°C in -0.5°C steps, 20 cycles, 55°C 24 cycles 3U BSI1
rs 1130866 TGGGGGATTAGGGGTCAGTC CCATGGGTGGGCACAGGGG 65°-55°C in -0.5°C steps, 20 cycles, 55°C 20 cycles 1U TaaI
rs2040349 GACACTGGAGACGGAGGACT AAAGCCAGCTGATGCTCTTC 65°-55°C in -0.5°C steps, 20 cycles, 55°C 20 cycles 1U NIaIV
rs 3024801 CCTAACACTCCCACCCTGTG TCCTCCCCTCTCTCTTCCTC 65°-55°C in -0.5°C steps, 20 cycles, 55°C 20 cycles pool sequencing
rs 3024809 GCTACTCCGTCATCCTGCTC GCCCATACCTTTTCCCTGTC 65°-55°C in -0.5°C steps, 20 cycles, 55°C 20 cycles pool sequencing