Skip to main content

Table 1 Probe and primer sequences and protocol for real-time PCR targeting Mycobacterium lentiflavum

From: Prevalence of Mycobacterium lentiflavum in cystic fibrosis patients, France

Target gene smpB
Primers  
MlentismpB MBF CAACTTGCACATTCCCGAGT
MlentismpB MBR CCCGATCAGTGTGTCGATCT
Probe  
MlentismpB MBR 6FAM-TCGCACTCGGAAGTTGTTGTTACATAGGC
Dilution 0.1 nmol/μL then 1/40
  1. The extraction of DNA was performed using the EZ1 DNA tissue kit with a Qiagen EZ1 extractor Advanced XL (Qiagen, Courtaboeuf, France) according to the manufacturer’s recommendations. Real-time PCR was performed using a Biorad CFX96 thermocycler with the FAST qPCR MasterMix Plus No ROX kit (Eurogentec, Angers, France) according to the manufacturer’s recommendations: five minutes at 95 °C for activation, followed by 40 cycles of 95 °C for 10 s and 60 °C for 35 secons. Amplification products were analyzed using Biorad software