Skip to main content

Table 2 DNA primers (5′-3′)

From: Effect of sub-chronic exposure to cigarette smoke, electronic cigarette and waterpipe on human lung epithelial barrier function

Gene Forward Reverse Product (bp)
CDH1 CCCACCACGTACAAGGGTC CTGGGGTATTGGGGGCATC 94
GAPDH AACGGGAAGCTCACTGGCATG TCCACCACCTGTTGCTGTAG 304