Skip to main content

Table 1 primer

From: Inhibition of overexpressed Kv3.4 augments HPV in endotoxemic mice

  Forward primer Reverse primer
Kv3.4 TTGACCGAAACGTGACGGAG TGTAGGTAAGAATGGGCTCTGT
Kv6.3 GGGCACTACGCATCCTCTAC CACAGCCAGGAAGAGCATCA
Kv9.3 GGACTCGGCGACCCGT CCATCACATGCAGCTTCCCT
18S TCAAGAACGAAAGTCGGAGG GGACATCTAAGGGCATCAC