Skip to main content

Table 1 Primer sequences of rat N1ICD-encoding cDNA

From: Notch1 activation of Jagged1 contributes to differentiation of mesenchymal stem cells into endothelial cells under cigarette smoke extract exposure

Gene Primer sequence
Notch1-P1 5′GAGGATCCCCGGGTACCGGTCGCCACCATGCGCAAGCGCAGGCGGCAGCATG3′
Notch1-P2 5′TCCTTGTAGTCCATACCCTTAAATGCCTCTGGAATGTGGGTG3′