Skip to main content

Table 1 Primer sequences and cycling details for multiplex PCR and SNaPshot

From: Comparison of next generation sequencing, SNaPshot assay and real-time polymerase chain reaction for lung adenocarcinoma EGFR mutation assessment

Primer Primer sequence Amplification conditions
  Multiplex PCR - Primers and Cycling Conditions  
EGFR Ex 18 FWD 5′- CCCCCCCAGCTTGTGG -3′ 95OC - 3 min
45 cycles of:
94OC - 30 s
63OC - 90 s
72OC - 90 s
Final extension
72OC - 10 min
4 OC - end
EGFR Ex 18 REV 5′- ACCGTGCCGAACGCAC -3′
EGFR Ex 20 FWD 5′- CTCTCCCTCCCTCCAGGAAG -3′
EGFR Ex 20 REV 5′- TTCCCGGACATAGTCCAGGA -3′
EGFR Ex 21 FWD 5′- CGCAGCATGTCAAGATCACAG -3′
EGFR Ex 21 REV 5′- TGGCTGACCTAAAGCCACCT -3′
  SNaPShot Assay - Primers and Cycling Conditions  
EGFR-2155R 5′- TGGTTAGATGGAACGCACCGGAGC -3′ 96OC - 10 s
25 cycles of:
50OC 5 s
60OC - 30 s
Final:
4OC - ∞ min
EGFR-2156R 5′- TAGATGTGGTTAGATGCGAACGCACCGGAG -3′
EGFR-2369R 5′- TGGTTAGATGTGGTTAGATGGAAGGGCATGAGCTGC -3′
EGFR-2573 F 5′- ATGTGGTTAGATGTGGTTAGATGAAGATCACAGATTTTGGGC -3′
EGFR-2582 F 5′- GATGTGGTTAGATGTGGTTAGATGTGGTTAGATGTGGGCTGGCCAAAC -3′
  Sizing Assay - Primers and Cycling conditions  
EGFR Ex19 FWD 5′ - GCACCATCTCACAATTGCCAGTTA-3 98OC - 3 min
45 cycles of:
98OC - 30 s
60OC - 60 s
72OC - 60 s
Final extention:
72OC 10 min
4OC - ∞ min
EGFR Ex19 REV 5′-/6FAM/AAAAGGTGGGCCTGAGGTTCA-3)