Skip to main content

Table 1 The sequences of primers used for RT-qPCR

From: Emodin inhibits viability, proliferation and promotes apoptosis of hypoxic human pulmonary artery smooth muscle cells via targeting miR-244-5p/DEGS1 axis

Gene Primer sequences 5’→3’
MiR-224-5p F: GCGCGCAAGTCACTAGTGG
R:GTCGTATCCAGTGCAGGGTCCGAGGT
ATTCGCACTGGATACGACAACGGAA
DEGS1 F: GCATCTTTACTTGGCCTGGGTT
R: ACTCCAGCACCATCTCTCCTT
β-actin F: CATGTACGTTGCTATCCAGGC
R: CTCCTTAATGTCACGCACGAT
U6 F: CTCGCTTCGGCAGCACATATACT
R: ACGCTTCACGAATTTGCGTGTC