Skip to main content

Table 2 Primer sequences used for real-time polymerase chain reaction

From: Notch1 activation of Jagged1 contributes to differentiation of mesenchymal stem cells into endothelial cells under cigarette smoke extract exposure

Gene Primer sequence Product length (bp)
Hey1 Forward:5’GCGCGGACGAGAATGGAAA3’
Reverse:5’TCAGGTGATCCACAGTCATCTG3’
231
HeyL Forward:5’CAGCCCTT CGCAGATGCAA3’
Reverse:5’CCAATCGTCGCAATTCAGAAAG3’
101
Hes3 Forward:5’ TGTCACTGGAGCAGCTAAGGT3’
Reverse:5’ ATCGGCCTTCTCCAGCTTTC3’
80
Hes5 Forward:5’ CGTCAGCTACCTGAAGCACAG 3’
Reverse:5’ CACCACGAGTAACCCTCGCT3’
90
VE-cadherin Forward:5’ AGATATCCGTGTGGGCAAGC 3’
Reverse:5’ CTGTACTCGCCCTGCATGAT 3’
102
eNOS Forward:5’ TGTGACCCTCACCGATACAA3’
Reverse:5’ CACAGCCACGTTAATTTCCA3’
117